Stem-loop sequence tca-mir-279a

AccessionMI0008924 (change log)
Previous IDstca-mir-279
DescriptionTribolium castaneum miR-279a stem-loop
Gene family MIPF0000184; mir-279
Literature search

2 open access papers mention tca-mir-279a
(8 sentences)

Stem-loop
             uc         g  ac    u 
5' cuugaugggu  gggucuagu gc  gguu u
   ||||||||||  ||||||||| ||  |||| u
3' gaauuacuca  ccuagauca ug  ucaa u
             ca         g  cu    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG7: 7544158-7544222 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-279a
tca-mir-279aChLG7: 7544158-7544222 [-]
tca-mir-279dChLG7: 7543987-7544128 [-]
Database links

Mature sequence tca-miR-279a-5p

Accession MIMAT0019125
Sequence

4 - 

gauggguucgggucuaguggcacg

 - 27

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-279a-3p

Accession MIMAT0008383
Previous IDstca-miR-279;tca-miR-279a
Sequence

43 - 

ugacuagauccacacucauuaa

 - 64

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).