Stem-loop sequence tca-mir-276

AccessionMI0008922 (change log)
DescriptionTribolium castaneum miR-276 stem-loop
Gene family MIPF0000124; mir-276
Literature search

2 open access papers mention tca-mir-276
(4 sentences)

Stem-loop
   uaga   cu    a     ag          --   u 
5'     cca  agcg gguau  aguuccuacg  uga u
       |||  |||| |||||  ||||||||||  |||  
3'     ggu  ucgu ccaua  ucaaggaugu  gcu u
   ---a   uc    g     cu          cg   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG3: 12023434-12023504 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-276
tca-mir-276bChLG3: 12023440-12023499 [+]
tca-mir-276ChLG3: 12023434-12023504 [-]
Database links

Mature sequence tca-miR-276-5p

Accession MIMAT0008380
Previous IDstca-miR-276*
Sequence

10 - 

agcgagguauagaguuccuacgug

 - 33

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-276-3p

Accession MIMAT0008381
Previous IDstca-miR-276
Sequence

46 - 

uaggaacuucauaccgugcucu

 - 67

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).