Stem-loop sequence tca-mir-275

AccessionMI0008921 (change log)
DescriptionTribolium castaneum miR-275 stem-loop
Gene family MIPF0000187; mir-275
Stem-loop
      a          c    -     a    -gg  u 
5' gcu cgcguguuac ucag uaccu ggcu   gg u
   ||| |||||||||| |||| ||||| ||||   ||  
3' cga gcgcgcgaug aguc augga cuga   cu u
      c          a    c     -    aag  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG9: 10587608-10587678 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-275
tca-mir-275ChLG9: 10587608-10587678 [-]
tca-mir-305ChLG9: 10587469-10587543 [-]
tca-mir-11628ChLG9: 10582062-10582156 [-]
Database links

Mature sequence tca-miR-275-5p

Accession MIMAT0019123
Sequence

7 - 

cguguuaccucaguaccuaggcugg

 - 31

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-275-3p

Accession MIMAT0008379
Previous IDstca-miR-275
Sequence

45 - 

ucagguaccugaaguagcgcgcg

 - 67

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).