Stem-loop sequence tca-mir-263b

AccessionMI0008920 (change log)
DescriptionTribolium castaneum miR-263b stem-loop
Gene family MIPF0000122; mir-263
Stem-loop
           ccu     c         u   a    gu 
5' cuuacgaa   uggca uggaagaau cac gauu  a
   ||||||||   ||||| ||||||||| ||| ||||  u
3' gggugcuu   accgu auuuucuua gug cuaa  u
           uau     a         -   -    gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG3: 4441784-4441858 [+]
intergenic
Database links

Mature sequence tca-miR-263b-5p

Accession MIMAT0008378
Previous IDstca-miR-263b
Sequence

10 - 

cuuggcacuggaagaauucac

 - 30

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-263b-3p

Accession MIMAT0019122
Sequence

47 - 

gugauucuuuuaaugccauau

 - 67

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).