Stem-loop sequence tca-mir-219

AccessionMI0008919 (change log)
DescriptionTribolium castaneum miR-219 stem-loop
Gene family MIPF0000044; mir-219
Stem-loop
           cc    u     a     a      uuugc 
5' uuucaggc  ugau gucca acgca uucuug     a
   ||||||||  |||| ||||| ||||| ||||||     a
3' agaguucg  acua caggu ugugu aggaac     u
           cu    -     g     c      uauuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG3: 5243252-5243329 [+]
intergenic
Database links

Mature sequence tca-miR-219-5p

Accession MIMAT0008377
Previous IDstca-miR-219
Sequence

11 - 

ugauuguccaaacgcaauucu

 - 31

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-219-3p

Accession MIMAT0019121
Sequence

49 - 

aggacuguguguggacaucauc

 - 70

Get sequence
Evidence experimental; SOLID [2]

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).