Stem-loop sequence tca-mir-210

AccessionMI0008918 (change log)
DescriptionTribolium castaneum miR-210 stem-loop
Gene family MIPF0000086; mir-210
Literature search

1 open access papers mention tca-mir-210
(1 sentences)

Stem-loop
        ugc        -g    u        ---       
5' cucac   agcugcug  acgc gcacaaga   uuagau 
   |||||   ||||||||  |||| ||||||||   ||||| a
3' gggug   ucggcgac  ugug cguguucu   gauuuu 
        uua        ag    -        caa       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG4: 6990664-6990739 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-210
tca-mir-11649ChLG4: 6991684-6991744 [-]
tca-mir-210ChLG4: 6990664-6990739 [-]
Database links

Mature sequence tca-miR-210-5p

Accession MIMAT0019120
Sequence

9 - 

agcugcuggacgcugcacaag

 - 29

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-210-3p

Accession MIMAT0008376
Previous IDstca-miR-210
Sequence

49 - 

uugugcgugugacagcggcua

 - 69

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).