Stem-loop sequence tca-mir-190

AccessionMI0008917 (change log)
DescriptionTribolium castaneum miR-190 stem-loop
Gene family MIPF0000076; mir-190
Literature search

1 open access papers mention tca-mir-190
(1 sentences)

Stem-loop
   -    -   g      -            au      u  uauu 
5'  guga guu cuauaa gauauguuugau  ucuugg ug    u
    |||| ||| |||||| ||||||||||||  |||||| ||    u
3'  cacu cga gauauu uuauacaaacug  aggacc ac    u
   g    g   a      a            --      c  uuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG7: 782727-782812 [-]
intergenic
Database links

Mature sequence tca-miR-190-5p

Accession MIMAT0008375
Previous IDstca-miR-190
Sequence

14 - 

agauauguuugauauucuugg

 - 34

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-190-3p

Accession MIMAT0019119
Sequence

51 - 

cccaggagucaaacauau

 - 68

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).