Stem-loop sequence tca-mir-184

AccessionMI0008916 (change log)
DescriptionTribolium castaneum miR-184 stem-loop
Gene family MIPF0000059; mir-184
Stem-loop
   uu    uc   u         -     u  c     -  au 
5'   uucu  cag cccuuguca uucuc cg ccggu gu  u
     ||||  ||| ||||||||| ||||| || ||||| ||   
3'   aagg  guu gggaauagu aagag gc gguca ca  u
   --    gu   c         c     -  a     a  au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG7: 8771100-8771178 [-]
intergenic
Database links

Mature sequence tca-miR-184-5p

Accession MIMAT0019118
Sequence

14 - 

ccuugucauucucucgcccggu

 - 35

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-184-3p

Accession MIMAT0008374
Previous IDstca-miR-184
Sequence

49 - 

uggacggagaacugauaagggc

 - 70

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).