Stem-loop sequence tca-mir-137

AccessionMI0008915 (change log)
DescriptionTribolium castaneum miR-137 stem-loop
Gene family MIPF0000106; mir-137
Literature search

1 open access papers mention tca-mir-137
(1 sentences)

Stem-loop
   ug  ug uc           ug      u    ca au 
5'   gu  g  acguguauucu  gguaau aaca  u  u
     ||  |  |||||||||||  |||||| ||||  |   
3'   ca  c  ugcacauaaga  ucguua uugu  g  c
   aa  gu ga           gu      -    ag ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG7: 3688025-3688101 [-]
intergenic
Database links

Mature sequence tca-miR-137-5p

Accession MIMAT0019117
Sequence

10 - 

acguguauucuuggguaauuaacac

 - 34

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-137-3p

Accession MIMAT0008373
Previous IDstca-miR-137
Sequence

48 - 

uuauugcuugagaauacacgua

 - 69

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).