Stem-loop sequence tca-mir-133

AccessionMI0008914 (change log)
DescriptionTribolium castaneum miR-133 stem-loop
Gene family MIPF0000029; mir-133
Literature search

1 open access papers mention tca-mir-133
(1 sentences)

Stem-loop
          g     u            ucc  gu     u  a 
5' gcaaugu cagcu uagcugguugaa   gg  caaau gu a
   ||||||| ||||| ||||||||||||   ||  ||||| ||  
3' cguuaca guugg gucgaccaacuu   cc  guuua cg a
          -     u            -cc  ug     u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG5: 10226396-10226479 [-]
intergenic
Database links

Mature sequence tca-miR-133-5p

Accession MIMAT0019116
Sequence

16 - 

agcugguugaauccggguca

 - 35

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-133-3p

Accession MIMAT0008372
Previous IDstca-miR-133
Sequence

51 - 

uugguccccuucaaccagcugu

 - 72

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).