Stem-loop sequence tca-mir-125

AccessionMI0008913 (change log)
DescriptionTribolium castaneum miR-125 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
          uauuc      a c   a       -u   a 
5' auuugcc     ccugag c cua cuuguga  guu a
   |||||||     |||||| | ||| |||||||  ||| a
3' uaggcgg     gggcuc g gau gaacacu  cag u
          -uuau      a c   c       cu   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG6: 4533611-4533687 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-125
tca-mir-100ChLG6: 4533288-4533363 [+]
tca-let-7ChLG6: 4533422-4533499 [+]
tca-mir-125ChLG6: 4533611-4533687 [+]
Database links

Mature sequence tca-miR-125-5p

Accession MIMAT0008371
Previous IDstca-miR-125
Sequence

11 - 

ucccugagacccuaacuuguga

 - 32

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-125-3p

Accession MIMAT0019115
Sequence

49 - 

acaagcuagcgacucggguauug

 - 71

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).