Stem-loop sequence tca-mir-124

AccessionMI0008912 (change log)
DescriptionTribolium castaneum miR-124 stem-loop
Gene family MIPF0000021; mir-124
Stem-loop
   --   auu   cua           ug    g     uuu 
5'   guc   cuc   guguucacugu  gccu uaugu   u
     |||   |||   |||||||||||  |||| |||||   g
3'   cag   gag   cguaaguggcg  cgga auacg   u
   uu   -ac   aac           ca    -     caa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG5: 13288829-13288907 [-]
intergenic
Database links

Mature sequence tca-miR-124-5p

Accession MIMAT0019114
Sequence

12 - 

aguguucacuguuggccuguau

 - 33

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-124-3p

Accession MIMAT0008370
Previous IDstca-miR-124
Sequence

48 - 

uaaggcacgcggugaaugccaag

 - 70

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).