Stem-loop sequence tca-mir-100

AccessionMI0008911 (change log)
DescriptionTribolium castaneum miR-100 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   ---au     -  a          cc          ggc 
5'      ccggu gg acccguagau  gaacuugugg   u
        ||||| || ||||||||||  ||||||||||    
3'      gguca cc uggguauuug  cuugaacacu   g
   aagau     u  a          uu          ggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG6: 4533288-4533363 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-100
tca-mir-100ChLG6: 4533288-4533363 [+]
tca-let-7ChLG6: 4533422-4533499 [+]
tca-mir-125ChLG6: 4533611-4533687 [+]
Database links

Mature sequence tca-miR-100-5p

Accession MIMAT0008369
Previous IDstca-miR-100
Sequence

10 - 

aacccguagauccgaacuuguggg

 - 33

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-100-3p

Accession MIMAT0019113
Sequence

44 - 

caaguucuuguuuauggguacc

 - 65

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).