Stem-loop sequence tca-mir-92b

AccessionMI0008910 (change log)
DescriptionTribolium castaneum miR-92b stem-loop
Gene family MIPF0000013; mir-25
Literature search

1 open access papers mention tca-mir-92b
(7 sentences)

Stem-loop
          guu       u u uu     -----   u    u 
5' cuguguc   uaggucg g c  gugca     acu gugg u
   |||||||   ||||||| | |  |||||     ||| |||| u
3' gacacgg   guccggc c g  cacgu     uga uacu u
          aac       c u uu     uaaac   u    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG8: 2516719-2516800 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-92b
tca-mir-92aChLG8: 2516169-2516246 [+]
tca-mir-92bChLG8: 2516719-2516800 [+]
Database links

Mature sequence tca-miR-92b-5p

Accession MIMAT0019112
Sequence

12 - 

aggucgugucuugugcaacuug

 - 33

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-92b-3p

Accession MIMAT0008368
Previous IDstca-miR-92b
Sequence

53 - 

auugcacuugucccggccug

 - 72

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).