Stem-loop sequence tca-mir-92a

AccessionMI0008909 (change log)
DescriptionTribolium castaneum miR-92a stem-loop
Gene family MIPF0000013; mir-25
Literature search

1 open access papers mention tca-mir-92a
(7 sentences)

Stem-loop
   -            u   u   gc   a       ua uu 
5'  cgcuuucaguag ccg gau  gug caauauu  g  u
    |||||||||||| ||| |||  ||| |||||||  |   
3'  gcgggaguuauc ggc cug  cac guuauaa  u  u
   c            c   c   au   -       gc uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG8: 2516169-2516246 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-92a
tca-mir-92aChLG8: 2516169-2516246 [+]
tca-mir-92bChLG8: 2516719-2516800 [+]
Database links

Mature sequence tca-miR-92a-5p

Accession MIMAT0019111
Sequence

11 - 

aguccgugaugcgugacaauau

 - 32

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-92a-3p

Accession MIMAT0008367
Previous IDstca-miR-92a
Sequence

49 - 

auugcacuagucccggccua

 - 68

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).