Stem-loop sequence tca-mir-87a

AccessionMI0008908 (change log)
Previous IDstca-mir-87
DescriptionTribolium castaneum miR-87a stem-loop
Gene family MIPF0000152; mir-87
Stem-loop
   c    g      g        uc      u   ---g   u 
5'  aguc uugacg gcuugaaa  uugcuc ccc    uga u
    |||| |||||| ||||||||  |||||| |||    ||| a
3'  ucgg aacugu uggacuuu  aacgag ggg    gcu u
   u    a      g        ga      u   aaau   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG6: 1651407-1651488 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-87a
tca-mir-87aChLG6: 1651407-1651488 [+]
tca-mir-87bChLG6: 1654265-1654362 [+]
Database links

Mature sequence tca-miR-87a-5p

Accession MIMAT0019110
Sequence

12 - 

gggcuugaaaucuugcucuccc

 - 33

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-87a-3p

Accession MIMAT0008366
Previous IDstca-miR-87
Sequence

52 - 

gugagcaaaguuucaggugug

 - 72

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).