Stem-loop sequence tca-mir-34

AccessionMI0008906 (change log)
DescriptionTribolium castaneum miR-34 stem-loop
Gene family MIPF0000039; mir-34
Literature search

1 open access papers mention tca-mir-34
(1 sentences)

Stem-loop
   --    a  c  u  c       u   c        u  u 
5'   augu ca gg gg agugugg uag ugguugug uu u
     |||| || || || ||||||| ||| |||||||| ||  
3'   uaua gu cc cc ucauacc auc accagcac ag u
   gc    a  a  u  c       u   -        u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG7: 13763505-13763583 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-34
tca-mir-277ChLG7: 13758830-13758910 [+]
tca-mir-34ChLG7: 13763505-13763583 [+]
Database links

Mature sequence tca-miR-34-5p

Accession MIMAT0008364
Previous IDstca-miR-34
Sequence

11 - 

uggcagugugguuagcuggu

 - 30

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-34-3p

Accession MIMAT0019108
Sequence

47 - 

cgaccacuauccauacucccucc

 - 69

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).