Stem-loop sequence tca-mir-33

AccessionMI0008905 (change log)
DescriptionTribolium castaneum miR-33 stem-loop
Gene family MIPF0000070; mir-33
Stem-loop
   -agaaga    u      auc      -      u  uu         guua 
5'        ugaa auuaug   uuaggu gcauug ag  gcauugcau    u
          |||| ||||||   |||||| |||||| ||  |||||||||     
3'        acuu uaauac   gauuca cgugac uc  ugugacgug    u
   ucuccac    -      -gc      a      c  uc         aaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG4: 8178499-8178600 [-]
intergenic
Database links

Mature sequence tca-miR-33-5p

Accession MIMAT0008363
Previous IDstca-miR-33
Sequence

25 - 

gugcauuguaguugcauugcaug

 - 47

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-33-3p

Accession MIMAT0019107
Sequence

60 - 

cagugucucuccagugcaacu

 - 80

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).