Stem-loop sequence tca-mir-31

AccessionMI0008904 (change log)
Previous IDstca-mir-31a
DescriptionTribolium castaneum miR-31 stem-loop
Gene family MIPF0000064; mir-31
Literature search

1 open access papers mention tca-mir-31
(1 sentences)

Stem-loop
        -a   ca   aa    uc          aaggu 
5' gaggc  gag  ggc  gaug  ggcauagcug     g
   |||||  |||  |||  ||||  ||||||||||     u
3' uuccg  uuc  ccg  cuac  cuguaucggc     u
        aa   aa   gc    -u          aaagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG7: 5322477-5322553 [+]
intergenic
Database links

Mature sequence tca-miR-31-5p

Accession MIMAT0008362
Previous IDstca-miR-31a
Sequence

11 - 

aggcaagaugucggcauagcu

 - 31

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-31-3p

Accession MIMAT0019106
Sequence

47 - 

ggcuaugucucauccggccaac

 - 68

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).