Stem-loop sequence tca-mir-14

AccessionMI0008903 (change log)
DescriptionTribolium castaneum miR-14 stem-loop
Gene family MIPF0000182; mir-14
Stem-loop
   gac  c       g  c       c   uu     u   u  u 
5'    uc aaugggu aa aggggag gga  ggacu acu uu u
      || ||||||| || ||||||| |||  ||||| ||| || u
3'    ag uuaccua uu uccucuc cuu  ucuga uga aa c
   --u  c       a  a       u   uu     c   c  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG3: 2755793-2755879 [+]
intergenic
Database links

Mature sequence tca-miR-14-5p

Accession MIMAT0019105
Sequence

18 - 

aggggagcggauuggacuuacu

 - 39

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-14-3p

Accession MIMAT0008361
Previous IDstca-miR-14
Sequence

53 - 

ucagucuuuuucucucuccuau

 - 74

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).