Stem-loop sequence tca-mir-13b

AccessionMI0008902 (change log)
DescriptionTribolium castaneum miR-13b stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
   -u   cu  ca     uu         a   ua ua 
5'   gcc  au  gucaa  ugguuguga acc  g  u
     |||  ||  |||||  ||||||||| |||  |  u
3'   ugg  ug  caguu  accgacacu ugg  u  u
   gu   uu  ag     uu         a   gc ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG3: 562739-562812 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-13b
tca-mir-3842ChLG3: 560957-561052 [+]
tca-mir-71ChLG3: 562386-562464 [+]
tca-mir-2-3ChLG3: 562500-562582 [+]
tca-mir-13aChLG3: 562623-562702 [+]
tca-mir-13bChLG3: 562739-562812 [+]
tca-mir-2-1ChLG3: 562865-562952 [+]
tca-mir-2-2ChLG3: 563018-563102 [+]
Database links

Mature sequence tca-miR-13b-5p

Accession MIMAT0019104
Sequence

9 - 

cagucaauuugguugugaaaccu

 - 31

Get sequence
Evidence experimental; SOLID [2]

Mature sequence tca-miR-13b-3p

Accession MIMAT0008360
Previous IDstca-miR-13b
Sequence

46 - 

uaucacagccauuuugacgagu

 - 67

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).