Stem-loop sequence tca-mir-13a

AccessionMI0008901 (change log)
DescriptionTribolium castaneum miR-13a stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
        gc     -       uu         ac  uuaa 
5' gagau  ccaag ucgucaa  ugguuguga  uc    u
   |||||  ||||| |||||||  |||||||||  ||    u
3' uucug  gguuc aguaguu  accgacacu  ag    u
        uu     g       uc         au  caaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG3: 562623-562702 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-13a
tca-mir-3842ChLG3: 560957-561052 [+]
tca-mir-71ChLG3: 562386-562464 [+]
tca-mir-2-3ChLG3: 562500-562582 [+]
tca-mir-13aChLG3: 562623-562702 [+]
tca-mir-13bChLG3: 562739-562812 [+]
tca-mir-2-1ChLG3: 562865-562952 [+]
tca-mir-2-2ChLG3: 563018-563102 [+]
Database links

Mature sequence tca-miR-13a-5p

Accession MIMAT0019103
Sequence

13 - 

ucgucaauuugguugugaacuc

 - 34

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-13a-3p

Accession MIMAT0008359
Previous IDstca-miR-13a
Sequence

48 - 

uaucacagccacuuugaugagc

 - 69

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).