Stem-loop sequence tca-mir-12

AccessionMI0008900 (change log)
DescriptionTribolium castaneum miR-12 stem-loop
Gene family MIPF0000181; mir-12
Literature search

1 open access papers mention tca-mir-12
(1 sentences)

Stem-loop
          u      u     a    a     u       cggu 
5' uaaaagu cagggu ugagu uuac ucagg acugguu    u
   ||||||| |||||| ||||| |||| ||||| |||||||    u
3' auuuucg gucuua auuca aaug agucc uggccaa    u
          -      c     c    -     c       aaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG3: 19663493-19663579 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-12
tca-mir-283ChLG3: 19667898-19667973 [-]
tca-mir-3477ChLG3: 19663710-19663810 [-]
tca-mir-12ChLG3: 19663493-19663579 [-]
Database links

Mature sequence tca-miR-12-5p

Accession MIMAT0008358
Previous IDstca-miR-12
Sequence

16 - 

ugaguauuacaucagguacug

 - 36

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-12-3p

Accession MIMAT0019102
Sequence

54 - 

cggucccugaguaacacuuaca

 - 75

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).