Stem-loop sequence tca-mir-10

AccessionMI0008899 (change log)
DescriptionTribolium castaneum miR-10 stem-loop
Gene family MIPF0000033; mir-10
Literature search

3 open access papers mention tca-mir-10
(4 sentences)

Stem-loop
   cucua   cu   -  g    u           ---  a 
5'      cau  acc cu uaga ccgaauuuguu   ug a
        |||  ||| || |||| |||||||||||   ||  
3'      gug  ugg ga aucu ggcuuaaacag   ac a
   -----   uu   a  g    u           cgg  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG2: 8102694-8102764 [+]
intergenic
Database links

Mature sequence tca-miR-10-5p

Accession MIMAT0008357
Previous IDstca-miR-10
Sequence

10 - 

uacccuguagauccgaauuugu

 - 31

Get sequence
Evidence experimental; SOLID [3]
Database links

Mature sequence tca-miR-10-3p

Accession MIMAT0019101
Sequence

46 - 

caaauucgguucuagagagguuu

 - 68

Get sequence
Evidence experimental; SOLID [3]
Database links

References

1
PMID:18392875 "Analysis of the Tribolium homeotic complex: insights into mechanisms constraining insect Hox clusters" Shippy TD, Ronshaugen M, Cande J, He J, Beeman RW, Levine M, Brown SJ, Denell RE Dev Genes Evol. 218:127-139(2008).
2
3
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).