Stem-loop sequence tca-mir-8

AccessionMI0008898 (change log)
DescriptionTribolium castaneum miR-8 stem-loop
Gene family MIPF0000019; mir-8
Literature search

1 open access papers mention tca-mir-8
(4 sentences)

Stem-loop
   acuguua       -   g     c      uuacau 
5'        acaucuu acc ggcag auuaga      u
          ||||||| ||| ||||| ||||||       
3'        uguagaa ugg cuguc uaaucu      u
   --ccucc       a   a     a      ucauau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tca-miR-8-5p

Accession MIMAT0019100
Sequence

9 - 

caucuuaccgggcagcauuaga

 - 30

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-8-3p

Accession MIMAT0008356
Previous IDstca-miR-8
Sequence

47 - 

uaauacugucagguaaagauguc

 - 69

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).