Stem-loop sequence tca-mir-7

AccessionMI0008897 (change log)
DescriptionTribolium castaneum miR-7 stem-loop
Gene family MIPF0000022; mir-7
Stem-loop
   u   g     u   a  c          g     - uaau 
5'  ggu uugug gga ga uagugauuuu uuguu c    u
    ||| ||||| ||| || |||||||||| ||||| |     
3'  ccg aacac ccu cu aucacuaagg aacaa g    u
   -   a     -   a  a          -     u cauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG7: 1803460-1803537 [+]
intergenic
Database links

Mature sequence tca-miR-7-5p

Accession MIMAT0008355
Previous IDstca-miR-7
Sequence

11 - 

uggaagacuagugauuuuguuguuc

 - 35

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-7-3p

Accession MIMAT0019099
Sequence

50 - 

caaggaaucacuaaucaucccac

 - 72

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).