Stem-loop sequence tca-let-7

AccessionMI0008896 (change log)
DescriptionTribolium castaneum let-7 stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention tca-let-7
(5 sentences)

Stem-loop
        uuu   g                 aguauuaca  u 
5' gucug   gag uaguagguuguauagua         cc a
   |||||   ||| |||||||||||||||||         ||  
3' cagac   uuc aucguccgacaugucgu         gg u
        ccu   a                 ------gag  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG6: 4533422-4533499 [+]
intergenic
Clustered miRNAs
< 10kb from tca-let-7
tca-mir-100ChLG6: 4533288-4533363 [+]
tca-let-7ChLG6: 4533422-4533499 [+]
tca-mir-125ChLG6: 4533611-4533687 [+]
Database links

Mature sequence tca-let-7-5p

Accession MIMAT0008354
Previous IDstca-let-7
Sequence

8 - 

ugagguaguagguuguauag

 - 27

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-let-7-3p

Accession MIMAT0019098
Sequence

52 - 

cuguacagccugcuaacuuuccc

 - 74

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).