Stem-loop sequence tca-let-7

Accession MI0008896
Description Tribolium castaneum let-7 stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     uuu   g                 aguauuaca  u 
gucug   gag uaguagguuguauagua         cc a
|||||   ||| |||||||||||||||||         ||  
cagac   uuc aucguccgacaugucgu         gg u
     ccu   a                 ------gag  u 
Get sequence
Deep sequencing
9614 reads, 2 experiments
Genome context
Coordinates (Tcas3.0) Overlapping transcripts
chrLG6: 6881406-6881483 [+]
intergenic
Clustered miRNAs
< 10kb from tca-let-7
tca-mir-100 chrLG6: 6881272-6881347 [+]
tca-let-7 chrLG6: 6881406-6881483 [+]
tca-mir-125 chrLG6: 6881595-6881671 [+]
Database links

Mature sequence tca-let-7-5p

Accession MIMAT0008354
Previous IDs tca-let-7
Sequence

8 - 

ugagguaguagguuguauag

 - 27

Get sequence
Deep sequencing 7084 reads, 2 experiments
Evidence experimental; SOLID [2]

Mature sequence tca-let-7-3p

Accession MIMAT0019098
Sequence

52 - 

cuguacagccugcuaacuuuccc

 - 74

Get sequence
Deep sequencing 2530 reads, 2 experiments
Evidence experimental; SOLID [2]

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).