Stem-loop sequence tca-mir-2-2

AccessionMI0008895 (change log)
Previous IDstca-mir-2-2
DescriptionTribolium castaneum miR-2-2 stem-loop
Gene family MIPF0000049; mir-2
Literature search

2 open access papers mention tca-mir-2-2
(6 sentences)

Stem-loop
         gg   u         --u          aa     au 
5' ggugua  cuu cgcucauca   cugguuguga  uguga  u
   ||||||  ||| |||||||||   ||||||||||  |||||  u
3' ucacgu  gaa gcgaguagu   gaccgacacu  auacu  a
         ga   c         uuc          --     au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG3: 563018-563102 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-2-2
tca-mir-3842ChLG3: 560957-561052 [+]
tca-mir-71ChLG3: 562386-562464 [+]
tca-mir-2-3ChLG3: 562500-562582 [+]
tca-mir-13aChLG3: 562623-562702 [+]
tca-mir-13bChLG3: 562739-562812 [+]
tca-mir-2-1ChLG3: 562865-562952 [+]
tca-mir-2-2ChLG3: 563018-563102 [+]
Database links

Mature sequence tca-miR-2-2-5p

Accession MIMAT0019096
Sequence

14 - 

gcucaucaucugguugug

 - 31

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-2-3p

Accession MIMAT0008353
Previous IDstca-miR-2
Sequence

50 - 

uaucacagccagcuuugaugagc

 - 72

Get sequence
Evidence experimental; SOLID [2]

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).