Stem-loop sequence tca-mir-2-3

AccessionMI0008893 (change log)
Previous IDstca-mir-2-3
DescriptionTribolium castaneum miR-2-3 stem-loop
Gene family MIPF0000049; mir-2
Literature search

2 open access papers mention tca-mir-2-3
(6 sentences)

Stem-loop
          u    c               g  uu    uua 
5' agucuug cugu cuuaucagaguuggc gu  uaga   a
   ||||||| |||| ||||||||||||||| ||  ||||   c
3' uuagagu gaca gaguaguuucgaccg ca  aucu   u
          u    c               a  cu    uag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG3: 562500-562582 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-2-3
tca-mir-3842ChLG3: 560957-561052 [+]
tca-mir-71ChLG3: 562386-562464 [+]
tca-mir-2-3ChLG3: 562500-562582 [+]
tca-mir-13aChLG3: 562623-562702 [+]
tca-mir-13bChLG3: 562739-562812 [+]
tca-mir-2-1ChLG3: 562865-562952 [+]
tca-mir-2-2ChLG3: 563018-563102 [+]
Database links

Mature sequence tca-miR-2-3-5p

Accession MIMAT0019093
Sequence

14 - 

cuuaucagaguuggcgguu

 - 32

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-2-3p

Accession MIMAT0008353
Previous IDstca-miR-2
Sequence

49 - 

uaucacagccagcuuugaugagc

 - 71

Get sequence
Evidence experimental; SOLID [2]

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).