Stem-loop sequence tca-mir-1

AccessionMI0008892 (change log)
DescriptionTribolium castaneum miR-1 stem-loop
Gene family MIPF0000038; mir-1
Literature search

1 open access papers mention tca-mir-1
(2 sentences)

Stem-loop
   uucgcga            c    uuc     -  gc 
5'        guuccgugcuuc uuac   ccaua gu  u
          |||||||||||| ||||   ||||| ||  u
3'        cgagguaugaag aaug   gguau ca  u
   ----aag            a    uaa     g  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG5: 10252845-10252916 [-]
intergenic
Database links

Mature sequence tca-miR-1-5p

Accession MIMAT0019092
Sequence

11 - 

ccgugcuuccuuacuucccaua

 - 32

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-1-3p

Accession MIMAT0008352
Previous IDstca-miR-1
Sequence

47 - 

uggaauguaaagaaguauggag

 - 68

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).