Stem-loop sequence ptr-mir-936

AccessionMI0008883 (change log)
DescriptionPan troglodytes miR-936 stem-loop
Gene family MIPF0000517; mir-936
Stem-loop
   ucaa     cu     -------        -    aa  g   -aaa  a u 
5'     ggcca  gggac       aguagagg gagg  uc cag    uc c c
       |||||  |||||       |||||||| ||||  || |||    || |  
3'     ccggu  uccug       ucaucuuc uucc  ag guc    ag g c
   -gac     cg     gaccauu        g    ag  a   aacg  - a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr10: 105541068-105541164 [-]
sense
ENSPTRT00000063678 ; ptr-mir-936-201; exon 1
ENSPTRT00000005563 ; COL17A1-201; exon 30
Database links

Mature sequence ptr-miR-936

Accession MIMAT0008343
Sequence

15 - 

acaguagagggaggaaucgcag

 - 36

Get sequence
Evidence by similarity; MI0005758
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).