|
miRBase |
|
Stem-loop sequence ptr-mir-934 |
|||||
| Accession | MI0008881 | ||||
| Description | Pan troglodytes miR-934 stem-loop | ||||
| Gene family | MIPF0000542; mir-934 | ||||
| Stem-loop |
- c a uagu gaaauaaggcuucugucua uacuggagac cugg a ||||||||||||||||||| |||||||||| |||| u cuuuauuccgagggcaggu augaccucug gacc a u a a caaa |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence ptr-miR-934 |
|
| Accession | MIMAT0008341 |
| Sequence |
14 - ugucuacuacuggagacacugg - 35 |
| Evidence | by similarity; MI0005756 |
References |
|
| 1 |
PMID:18760970
"Computational identification of novel microRNA homologs in the chimpanzee genome"
Comput Biol Chem. 33:62-70(2009).
|