Stem-loop sequence ptr-mir-924

AccessionMI0008879 (change log)
DescriptionPan troglodytes miR-924 stem-loop
Gene family MIPF0000513; mir-924
Stem-loop
   -aa    g   ----  u    -    g 
5'    uaga ucu    ug gaug ucuu c
      |||| |||    || |||| |||| u
3'    aucu aga    ac cuac ggga u
   aac    g   ucca  -    c    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr18: 36801770-36801821 [-]
intergenic
Database links

Mature sequence ptr-miR-924

Accession MIMAT0008339
Sequence

4 - 

agagucuugugaugucuugc

 - 23

Get sequence
Evidence by similarity; MI0005716
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).