Stem-loop sequence ptr-mir-920

AccessionMI0008876 (change log)
DescriptionPan troglodytes miR-920 stem-loop
Gene family MIPF0000495; mir-920
Stem-loop
   --  ag     -      aaga    -aa    - agg 
5'   gu  uuguu cuacag    ccug   ugug c   a
     ||  ||||| ||||||    ||||   |||| |   g
3'   ca  gacga gguguc    ggac   acac g   c
   ua  au     a      gagg    cuc    a aau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr12: 66679449-66679522 [-]
intergenic
Database links

Mature sequence ptr-miR-920

Accession MIMAT0008336
Sequence

51 - 

ggggagcuguggaagcagua

 - 70

Get sequence
Evidence by similarity; MI0005712
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).