Stem-loop sequence ptr-mir-9-1

AccessionMI0008875 (change log)
DescriptionPan troglodytes miR-9-1 stem-loop
Gene family MIPF0000014; mir-9
Literature search

1 open access papers mention ptr-mir-9-1
(1 sentences)

Stem-loop
   c       guug   uc               g      u  ug 
5'  gggguug    uua  uuugguuaucuagcu uaugag gg  u
    |||||||    |||  ||||||||||||||| |||||| ||  g
3'  ccccaau    aau  aagccaauagaucga auacuu cu  g
   -       -aaa   ga               a      -  ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr1: 134550541-134550628 [-]
antisense
ENSPTRT00000054308 ; ptr-mir-9-1-201; exon 1
Database links

Mature sequence ptr-miR-9

Accession MIMAT0002275
Sequence

16 - 

ucuuugguuaucuagcuguauga

 - 38

Get sequence
Evidence by similarity; MI0000466
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).