Stem-loop sequence ptr-mir-889

Accession

MI0008870

Description

Pan troglodytes miR-889 stem-loop

Gene family

MIPF0000514; mir-889

Stem-loop

---    u   g     c      uagua     -  uau 
   ugcu aaa aaugg uguccg     ugguc uc   a
   |||| ||| ||||| ||||||     ||||| ||   u
   auga uuu uuacc acaggc     auuag ag   u
ccu    u   g     a      -uaua     u  uau 

Genome context

• Coordinates (PanTro2.1.4): 14: 100744558-100744635 [+]
• Overlapping transcripts:

  sense

  ENSPTRT00000063657 ; exon 1

  ENSPTRT00000063657 ; exon 1

  ENSPTRT00000063657 ; exon 1

Clustered miRNAs

< 10kb from ptr-mir-889

• ptr-mir-376c: 14: 100736361-100736425 [+]
• ptr-mir-376a-2: 14: 100736739-100736817 [+]
• ptr-mir-654: 14: 100736889-100736968 [+]
• ptr-mir-376b: 14: 100737106-100737204 [+]
• ptr-mir-376a-1: 14: 100737452-100737518 [+]
• ptr-mir-300: 14: 100738033-100738114 [+]
• ptr-mir-1185-1: 14: 100739642-100739726 [+]
• ptr-mir-1185-2: 14: 100740863-100740947 [+]
• ptr-mir-381: 14: 100742586-100742659 [+]
• ptr-mir-487b: 14: 100743121-100743203 [+]
• ptr-mir-539: 14: 100743978-100744054 [+]
• ptr-mir-889: 14: 100744558-100744635 [+]
• ptr-mir-544: 14: 100745309-100745398 [+]
• ptr-mir-655: 14: 100746189-100746296 [+]
• ptr-mir-487a: 14: 100749102-100749180 [+]
• ptr-mir-382: 14: 100750962-100751036 [+]
• ptr-mir-134: 14: 100751343-100751414 [+]
• ptr-mir-668: 14: 100751915-100751979 [+]
• ptr-mir-485: 14: 100752076-100752147 [+]
• ptr-mir-453: 14: 100752847-100752925 [+]

Database links

• ENTREZGENE: 100316276;MIR889

Mature sequence ptr-miR-889

• Accession: MIMAT0008331
• Sequence: 48 - uuaauaucggacaaccauugu - 68
• Evidence: by similarity; MI0005540

References

1. PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).