Stem-loop sequence ptr-mir-802

AccessionMI0008862 (change log)
DescriptionPan troglodytes miR-802 stem-loop
Gene family MIPF0000353; mir-802
Stem-loop
   ----uu      u     g c   a          a       -  cc 
5'       cuguua uugca u agu acaaagauuc uccuugu gu  a
         |||||| ||||| | ||| |||||||||| ||||||| ||  u
3'       gauaau aaugu a uca uguuucuaag aggaaca cg  c
   cagguc      u     g c   c          -       a  ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr21: 22185267-22185359 [+]
intergenic
Database links

Mature sequence ptr-miR-802

Accession MIMAT0008323
Sequence

17 - 

caguaacaaagauucauccuugu

 - 39

Get sequence
Evidence by similarity; MI0003906
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).