Stem-loop sequence ptr-mir-671

AccessionMI0008851 (change log)
DescriptionPan troglodytes miR-671 stem-loop
Gene family MIPF0000358; mir-671
Stem-loop
   -caggu aa     ----a    a        a   a      ga           -u   g 
5'       g  cuggc     ggcc ggaagagg gga gcccug  ggggcuggagg  gau g
         |  |||||     |||| |||||||| ||| ||||||  |||||||||||  |||  
3'       c  gaccg     ccgg cuuucucc ccu cgggac  ucuuggccucc  uug a
   cguggu gg     agaug    g        a   -      --           uu   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr7: 155489074-155489190 [+]
sense
ENSPTRT00000060863 ; ptr-mir-671-201; exon 1
ENSPTRT00000055122 ; ptr-mir-671-201; 3'UTR (exon 5)
KV420955.1: 1944656-1944772 [+]
sense
ENSPTRT00000060863 ; ptr-mir-671-201; exon 1
ENSPTRT00000055122 ; ptr-mir-671-201; 3'UTR (exon 5)
Database links

Mature sequence ptr-miR-671

Accession MIMAT0008314
Sequence

67 - 

uccgguucucagggcuccacc

 - 87

Get sequence
Evidence by similarity; MI0003760
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).