Stem-loop sequence ptr-mir-663a

AccessionMI0008846 (change log)
DescriptionPan troglodytes miR-663a stem-loop
Gene family MIPF0000462; mir-663
Stem-loop
   ccuu    - auc     -c  g   -        --     c   ug 
5'     ccgg c   ccagg  gg gcg ccgcggga  ccgcc ucg  u
       |||| |   |||||  || ||| ||||||||  ||||| |||   
3'     ggcc g   ggucc  uu ugc ggcgcccu  ggugg ggu  c
   uacc    c -gu     uu  g   c        ag     c   gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr20: 30127384-30127475 [-]
intergenic
Database links

Mature sequence ptr-miR-663a

Accession MIMAT0008309
Sequence

15 - 

aggcggggcgccgcgggaccgc

 - 36

Get sequence
Evidence by similarity; MI0003672
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).