Stem-loop sequence ptr-mir-657

AccessionMI0008843 (change log)
DescriptionPan troglodytes miR-657 stem-loop
Gene family MIPF0000498; mir-657
Stem-loop
   guguaguagagcua        --   u        -a c u     g u        
5'               ggaggaga  ggg ccuggaga  g g ggacc g ccgggag 
                 ||||||||  ||| ||||||||  | | ||||| | |||||| g
3'               ucuccucu  ccc ggaucucu  c c cuugg c ggccuug 
   --------------        ua   c        cc a u     a -        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr17: 80830263-80830359 [-]
intergenic
Clustered miRNAs
< 10kb from ptr-mir-657
ptr-mir-1250chr17: 80838132-80838243 [-]
ptr-mir-338chr17: 80830870-80830935 [-]
ptr-mir-657chr17: 80830263-80830359 [-]
Database links

Mature sequence ptr-miR-657

Accession MIMAT0008306
Sequence

61 - 

ggcagguucucacccucucuagg

 - 83

Get sequence
Evidence by similarity; MI0003681
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).