Stem-loop sequence ptr-mir-650

AccessionMI0008838 (change log)
DescriptionPan troglodytes miR-650 stem-loop
Gene family MIPF0000457; mir-650
Stem-loop
   ------a     ----------     cuu     --    c     ca  a   ca 
5'        gugcu          ggggu   aggag  gcag gcucu  gg cgu  c
          |||||          |||||   |||||  |||| |||||  || |||  c
3'        cacgg          uccca   uccuc  cguc cggga  cc gua  a
   uagugga     gacucacucc     --c     cu    u     --  g   cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr22: 8895031-8895125 [+]
intergenic
Database links

Mature sequence ptr-miR-650

Accession MIMAT0008301
Sequence

15 - 

aggaggcagcgcucucaggac

 - 35

Get sequence
Evidence by similarity; MI0003665
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).