Stem-loop sequence ptr-mir-640

AccessionMI0008831 (change log)
DescriptionPan troglodytes miR-640 stem-loop
Gene family MIPF0000494; mir-640
Stem-loop
   ----------ugacccugggcaa       aa     gaca   ----     c 
5'                        guuccug  gauca    cau    cagau c
                          |||||||  |||||    |||    ||||| c
3'                        caaggac  cuagu    gua    gucua u
   gggguuccguugacaucuccguc       --     acgg   aaau     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr19: 20552253-20552347 [+]
sense
ENSPTRT00000019809 ; GATAD2A-201; intron 1
Database links

Mature sequence ptr-miR-640

Accession MIMAT0008294
Sequence

60 - 

augauccaggaaccugccucu

 - 80

Get sequence
Evidence by similarity; MI0003655
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).