Stem-loop sequence ptr-mir-633

AccessionMI0008827 (change log)
DescriptionPan troglodytes miR-633 stem-loop
Gene family MIPF0000546; mir-633
Stem-loop
   --a    ucu    cucu    cuu                        aaa 
5'    ccuc   uagc    guuu   uauugugguagauacuauuagccu   a
      ||||   ||||    ||||   ||||||||||||||||||||||||   u
3'    ggag   guug    uaaa   auaacaccaucuaugauaaucgga   g
   aua    --u    ---u    ---                        aga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr17: 62381689-62381785 [+]
intergenic
Database links

Mature sequence ptr-miR-633

Accession MIMAT0008290
Sequence

61 - 

uaauaguaucuaccacaauaaaa

 - 83

Get sequence
Evidence by similarity; MI0003648
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).