Stem-loop sequence ptr-mir-614

AccessionMI0008813 (change log)
DescriptionPan troglodytes miR-614 stem-loop
Gene family MIPF0000647; mir-614
Literature search

1 open access papers mention ptr-mir-614
(1 sentences)

Stem-loop
   cuaagaaac     gg   -   ga     -           ---   cc 
5'          gcagu  ucu cug  gucug caggagcaggc   cag  c
            |||||  ||| |||  ||||| |||||||||||   |||  u
3'          cgucg  gga gac  uggac guucuuguccg   guc  g
   ---------     uu   a   gg     c           caa   ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr12: 13489531-13489619 [+]
intergenic
Database links

Mature sequence ptr-miR-614

Accession MIMAT0008276
Sequence

53 - 

gaacgccuguucuugccaggugg

 - 75

Get sequence
Evidence by similarity; MI0003627
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).