Stem-loop sequence ptr-mir-605

AccessionMI0008808 (change log)
DescriptionPan troglodytes miR-605 stem-loop
Gene family MIPF0000528; mir-605
Stem-loop
   c                                  cu  gg 
5'  ccuagcuugguucuaaaucccauggugccuucuc  ug  a
    ||||||||||||||||||||||||||||||||||  ||  a
3'  ggauugaaccaagauuuaggguaucacggaagag  ac  a
   -                                  --  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr10: 52100288-52100369 [+]
sense
ENSPTRT00000004693 ; PRKG1-201; intron 2
Database links

Mature sequence ptr-miR-605

Accession MIMAT0008271
Sequence

15 - 

uaaaucccauggugccuucuccu

 - 37

Get sequence
Evidence by similarity; MI0003618
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).