|
miRBase |
|
Stem-loop sequence ptr-mir-601 |
|||||
| Accession | MI0008807 | ||||
| Description | Pan troglodytes miR-601 stem-loop | ||||
| Gene family | MIPF0000522; mir-601 | ||||
| Stem-loop |
ugcaugaguu --u u -- g a - ca caucu gg cu aggauu uugg gg agu g ||||| || || |||||| |||| || ||| a guggg cc ga uccuag gacc cc uca a ---------g uuu u ag g - a aa |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence ptr-miR-601 |
|
| Accession | MIMAT0008270 |
| Sequence |
16 - uggucuaggauuguuggaggag - 37 |
| Evidence | by similarity; MI0003614 |
References |
|
| 1 |
PMID:18760970
"Computational identification of novel microRNA homologs in the chimpanzee genome"
Comput Biol Chem. 33:62-70(2009).
|