Stem-loop sequence ptr-mir-572

AccessionMI0008785 (change log)
DescriptionPan troglodytes miR-572 stem-loop
Gene family MIPF0000537; mir-572
Stem-loop
   gucgaggccguggcccggaaguggucg          g  -    -a     c 
5'                            gggccgcugc ga cgga  gggcg c
                              |||||||||| || ||||  |||||  
3'                            cccgguggcg cu gccu  uucgu u
   ------------gggcgcccggaccga          g  c    gc     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr16: 2464814-2464907 [-]
sense
ENSPTRT00000014100 ; RNPS1-201; intron 1
Clustered miRNAs
< 10kb from ptr-mir-572
ptr-mir-940chr16: 2468786-2468878 [+]
ptr-mir-572chr16: 2464814-2464907 [-]
Database links

Mature sequence ptr-miR-572

Accession MIMAT0008248
Sequence

61 - 

guccgcucggcgguggccca

 - 80

Get sequence
Evidence by similarity; MI0003579
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).