Stem-loop sequence ptr-mir-556

AccessionMI0008774 (change log)
DescriptionPan troglodytes miR-556 stem-loop
Gene family MIPF0000475; mir-556
Stem-loop
   --------a                     c  u          cuucau 
5'          uaguaauaagaaagaugagcu au guaauaugag      u
            ||||||||||||||||||||| || ||||||||||       
3'          aucauuauuuuuucuacucga ua cauuauacuu      u
   acaacuucc                     u  c          uacaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr1: 140438995-140439088 [+]
sense
ENSPTRT00000054706 ; ptr-mir-556-201; exon 1
ENSPTRT00000002910 ; NOS1AP-201; intron 6
Database links

Mature sequence ptr-miR-556

Accession MIMAT0008237
Sequence

54 - 

auauuaccauuagcucaucuuu

 - 75

Get sequence
Evidence by similarity; MI0003562
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).