Stem-loop sequence ptr-mir-554

AccessionMI0008772 (change log)
DescriptionPan troglodytes miR-554 stem-loop
Gene family MIPF0000551; mir-554
Stem-loop
   ------  u   uaaccuu      --------          --      a   g 
5'       cc gag       ugcuag        uccugacuca  gccagu cug u
         || |||       ||||||        ||||||||||  |||||| |||  
3'       gg cuc       acgguu        gggacugggu  ugguca gau c
   ucuacg  u   --ucucu      uuauacuu          ag      -   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr1: 129525018-129525112 [+]
sense
ENSPTRT00000054765 ; ptr-mir-554-201; exon 1
Database links

Mature sequence ptr-miR-554

Accession MIMAT0008235
Sequence

15 - 

gcuaguccugacucagccagu

 - 35

Get sequence
Evidence by similarity; MI0003559
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).