Stem-loop sequence ptr-mir-552

AccessionMI0008770 (change log)
DescriptionPan troglodytes miR-552 stem-loop
Gene family MIPF0000501; mir-552
Stem-loop
   aaccauucaa                      uu ug        uu aa 
5'           auauaccacaguuuguuuaacc  u  ccuguugg  g  g
             ||||||||||||||||||||||  |  ||||||||  |  a
3'           uauauggugucaaacagauugg  a  ggacaacu  c  u
   --------ca                      uc gu        uu cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr1: 33991382-33991476 [-]
sense
ENSPTRT00000054594 ; ptr-mir-552-201; exon 1
Database links

Mature sequence ptr-miR-552

Accession MIMAT0008233
Sequence

61 - 

aacaggugacugguuagacaa

 - 81

Get sequence
Evidence by similarity; MI0003557
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).